software gom correlate pro 2022 Search Results


90
Carl Zeiss software gom correlate pro 2022
Software Gom Correlate Pro 2022, supplied by Carl Zeiss, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/software+gom+correlate+pro+2022/pmc12028420-101-8-12?v=Carl+Zeiss
Average 90 stars, based on 1 article reviews
software gom correlate pro 2022 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Carl Zeiss cad evaluation software gom inspect suite 2022
Cad Evaluation Software Gom Inspect Suite 2022, supplied by Carl Zeiss, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/software+gom+correlate+pro+2022/pmc11603675-184-11-21?v=Carl+Zeiss
Average 90 stars, based on 1 article reviews
cad evaluation software gom inspect suite 2022 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Carl Zeiss gom inspect 2022
Gom Inspect 2022, supplied by Carl Zeiss, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/software+gom+correlate+pro+2022/pm37981046-129-10-16?v=Carl+Zeiss
Average 90 stars, based on 1 article reviews
gom inspect 2022 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

N/A
MicroRNA: hsa-miR-888-5p Accession Number: MIMAT0004916 Mature Sequence: UACUCAAAAAGCUGUCAGUCA hsa-miR-888-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation,
  Buy from Supplier

N/A
Oligomycin B is an antibiotic that acts as a nonselective inhibitor of ATP5 (ATP synthase), produced by Streptomyces sp. Myocardial ischemia studies have revealed that Oligomycin B can reduce the rate of ATP depletion. Oligomycin
  Buy from Supplier

N/A
Oligomycin C is part of a class of macrolide antibiotics and is a potent inhibitor of cell regulatory volume decrease (RVD). Oligomycin has been shown to inhibit ATP synthase by blocking the ATP5 (mitochondrial F1F0-ATPase).
  Buy from Supplier

Image Search Results