90
|
Carl Zeiss
software gom correlate pro 2022 Software Gom Correlate Pro 2022, supplied by Carl Zeiss, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/software+gom+correlate+pro+2022/pmc12028420-101-8-12?v=Carl+Zeiss Average 90 stars, based on 1 article reviews
software gom correlate pro 2022 - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Carl Zeiss
cad evaluation software gom inspect suite 2022 Cad Evaluation Software Gom Inspect Suite 2022, supplied by Carl Zeiss, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/software+gom+correlate+pro+2022/pmc11603675-184-11-21?v=Carl+Zeiss Average 90 stars, based on 1 article reviews
cad evaluation software gom inspect suite 2022 - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Carl Zeiss
gom inspect 2022 Gom Inspect 2022, supplied by Carl Zeiss, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/software+gom+correlate+pro+2022/pm37981046-129-10-16?v=Carl+Zeiss Average 90 stars, based on 1 article reviews
gom inspect 2022 - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
N/A
|
MicroRNA: hsa-miR-888-5p Accession Number: MIMAT0004916 Mature Sequence: UACUCAAAAAGCUGUCAGUCA hsa-miR-888-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation,
|
Buy from Supplier |
N/A
|
Oligomycin B is an antibiotic that acts as a nonselective inhibitor of ATP5 (ATP synthase), produced by Streptomyces sp. Myocardial ischemia studies have revealed that Oligomycin B can reduce the rate of ATP depletion. Oligomycin
|
Buy from Supplier |
N/A
|
Oligomycin C is part of a class of macrolide antibiotics and is a potent inhibitor of cell regulatory volume decrease (RVD). Oligomycin has been shown to inhibit ATP synthase by blocking the ATP5 (mitochondrial F1F0-ATPase).
|
Buy from Supplier |